Sarna comum da batata em lavoura de São Francisco de Paula, RS / Potato Scab
20/01/2021

Ver ampliada

Figura 1. Tubérculo com crateras na superfície, sintoma de Sarna Comum (Streptomyces scabies) que pode ser confundido com Sarna Pulverulenta (Spongospora subterranea).


Ver ampliada

Figura 2. Tubérculo com crateras na superfície, sintoma de Sarna Comum (Streptomyces scabies) que pode ser confundido com Sarna Pulverulenta (Spongospora subterranea).


Ver ampliada

Figura 3. Tubérculos com crateras na superfície, sintoma de Sarna Comum (Streptomyces scabies), que pode ser confundido com Sarna Pulverulenta (Spongospora subterranea).


Ver ampliada

Figura 4. Tubérculo com crateras na superfície, sintoma de Sarna Comum (Streptomyces scabies), que pode ser confundido com Sarna Pulverulenta (Spongospora subterranea).


Ver ampliada

Figura 5. Sintoma inicial da Sarna Comum (Streptomyces scabies), positivo na PCR.


Ver ampliada

Figura 6. Tubérculos com crateras na superfície, sintoma de Sarna Comum (Streptomyces scabies), que pode ser confundido com Sarna Pulverulenta (Spongospora subterranea), particularmente se há histórico desta doença na área.


Ver ampliada

Figura 7. Tubérculos com crateras na superfície, sintoma de Sarna Comum (Streptomyces scabies), que pode ser confundido com Sarna Pulverulenta (Spongospora subterranea).


Ver ampliada

Figura 8. Tubérculos com crateras na superfície, sintoma de Sarna Comum (Streptomyces scabies).


Ver ampliada

Figura 9. Tubérculo com crateras na superfície, sintoma de Sarna Comum (Streptomyces scabies).


Ver ampliada

Figura 10. Tubérculos com sintomas ininiciais de Sarna Comum (Streptomyces scabies), positivos na  PCR.


Ver ampliada

Figura 11. Tubérculo com sintomas ininiciais de Sarna Comum (Streptomyces scabies), positivos na  PCR.


Ver ampliada

Figura 12. Tubérculo com sintomas ininiciais de Sarna Comum (Streptomyces scabies), positivos na  PCR.



Tubérculos de batata de lavoura de São Francisco de Paula, RS, foram recebidas pelo Agronômica no dia 20/01/2021, com suspeita de sarna pulverulenta (Spongospora subterranea), por já ter histórico desta doença. Os resultados das análises indicaram tratar-se de Sarna Comum, causada por Streptomyces scabies (Protocolo 171404).

Os primers Nf/Nr, que amplificam o gene Nec1 (Wanner, 2006), Nf- ATGAGCGCGAACGGAAGCCCCGGA, Nr - GCAGGTCGTCACGAAGGATCG, foram utilizados na PCR. O gene Nec1 codifica a proteína necrogênica Nec1, que é secretada e representa um importante fator de virulência independente associado à colonização e supressão da resposta de defesa da planta (Bukhalid et al., 1998; Joshi et al., 2007). Esse gene é conservado na maioria de Streptomyces spp. causadoras da sarna e está ausente em formas não patogênicas.

Há várias espécies de Streptomyces associadas à sarna da batata no Brasil, S. scabies, S. ipomoeae, S. caviscabiesS. setonii, S. europaeiscabiei, S. sampsonii, e possivelmente outras (Corrêa et al., 2011; Cruz, 2011).

Embora a sarna geralmente não afete a produção total, perdas econômicas significativas resultam da menor comercialização dos tubérculos. As perdas econômicas são maiores quando os tubérculos destinados à mesa e não para a indústria, pois a aparência é importante para esse mercado. Embora as lesões superficiais não afetem muito a comercialização do processamento de batatas, as lesões profundas, entretanto, aumentam as perdas por descascamento e prejudicam a aparência do produto processado. A ocorrência de sarna e sua severidade variam de acordo com a estação e de lavoura para lavoura. O histórico de cultivo, a umidade e a textura do solo são os grandes responsáveis por essa variabilidade. Lesões de sarna de batata podem ser confundidas com as da sarna pulverulenta, uma doença causada por um patógeno totalmente diferente, Spongospora subterranea (Loria, 1991; Marsden, 2005).

Variedades de batata de casca fina tendem a ser mais gravemente afetadas (Marsden, 2005).

Algumas estratégias de manejo recomendadas (Loria, 1991; Fischer et al., 2005; Marsden, 2005):

1. Use variedades resistentes em lavouras onde a sarna é um problema;

2. Use batata-sementes sem sarna e tratamentos para prevenir a introdução do patógeno nas lavouras. Os tratamentos das sementes não eliminam o patógeno, mas diminuem a fonte de inóculo. Consulte as recomendações atuais de controle de doenças da batata para tratamentos de sementes apropriados.

3. Rotação de culturas, evitando, por exemplo, cultivo com rabanete, beterraba ou cenoura. Use gramíenas, milho ou alfafa nas rotações; evite o trevo vermelho;

4. Mantenha os níveis de pH do solo entre 5,0 e 5,2, usando fertilizantes acidificantes, como o sulfato de amônio.

5. Evite o estresse por umidade durante 2 a 6 semanas após a tuberização.

Literatura consultada

Bukhalid, R. A.; Chung, S. Y. & Loria, R. 1998. nec1, a gene conferring a necrogenic phenotype, is conserved in plant-pathogenic Streptomyces spp. and linked to a transposase pseudogene. Mol. Plant. Microbe. Interact. 11:960–967 Disponível em: http://dx.doi.org/10.1094/MPMI.1998.11.10.960.

Corrêa, D. B. A. 2011. Caracterização morfológica, patogênica e molecular de linhagens de Streptomyces associadas à sarna da batata de diferentes regiões produtoras do Brasil. Disponível em: https://bdtd.ibict.br/vufind/Record/CAMP_65c643d2b6b57c15c19ebcdbbcaa8a0c.

Cruz, M. A. 2011. Identificadas espécies de bactérias que causam a sarna da batata. Jornal da Unicamp. Disponível em: https://www.unicamp.br/unicamp_hoje/ju/agosto2011/ju503_pag9.php. Acesso em: 13.fev.2021.

Duarte, V. Batata Ágata com sintoma de sarna (Streptomyces scabies). Agriporticus. Disponível em: http://www.agronomicabr.com.br/agriporticus/detalhe.aspx?id=610. Acesso em: 13.fev.2021.

Duarte, V. Sarna em rabanete? Agriporticus. Disponível em: http://www.agronomicabr.com.br/agriporticus/detalhe.aspx?id=617. Acesso em: 13.fev.2021.

Fischer, I. H.; Martins, M. C.; Lourenço, S. S. A.; Hiroshi Kimati, H. Efeito De Fertilizantes e Fungicidas na Incidência da Sarna da Batata. Batata Show, Ano 5, Abril 2005. 11: 9-10. Disponível em: http://www.abbabatatabrasileira.com.br/site/wp-content/uploads/2016/06/Edicao-11.pdf. Acesso em: 02.mar.2021.

Fischer, I. H.; Teixeira, A. P. M.; Toffano, L.; Garcia, E. Ol. (2009). Reação de cultivares de batata a Streptomyces scabies, agente causal da sarna comum profunda. Summa Phytopathologica, 35(3), 219-222. https://dx.doi.org/10.1590/S0100-54052009000300010

Joshi, M.; Rong, X.; Moll, S.; Kers, J.; Franco, C. & Loria, R. 2007. Streptomyces turgidiscabies secretes a novel virulence protein, Nec1, which facilitates infection. Mol. Plant. Microbe. Interact. 20:599–608 Disponível em: http://dx.doi.org/10.1094/MPMI-20-6-0599.

Lanza Destéfano, S. A. & Neto, J. R. 2004. Streptomyces spp. - Causadores da sarna da batata. ABBA - Associação brasileira da batata. Disponível em: http://www.abbabatatabrasileira.com.br/site/materias-das-revistas/streptomyces-spp-causadores-da-sarna-da-batata/. [Acesso em: 13.fev.2021].

Loria, R. 1991. Potato Scab fact sheet. Department of Plant Pathology, Cornell University. Disponível em: http://vegetablemdonline.ppath.cornell.edu/factsheets/Potato_Scab.htm. [Acesso em: 13.fev.2021].

Marsden, C. 2005. Potato Scab. Wisconsin Horticulture. Disponível em: https://hort.extension.wisc.edu/articles/potato-scab/. [Acesso em: 13.fev.2021].

Wanner, L. A. 2006. A survey of genetic variation in streptomyces isolates causing potato common scab in the United States. Phytopathology. 96:1363–1371 Disponível em: http://dx.doi.org/10.1094/PHYTO-96-1363.

*******

How to cite: Cardoza, Y. F.;  Ortys, P. C.; Martins, M. Sarna comum da batata em lavoura de São Francisco de Paula, RS / Potato Scab. Agriporticus. Disponível em: http://www.agronomicabr.com.br/agriporticus/detalhe.aspx?id=949. Acesso em:13.fev.2021 (Atualize a data de acesso.)

Nova busca

Sobreo projeto

O AgriPorticus é uma iniciativa do Agronômica visando compartilhar os registros de ocorrências de pragas e doenças, disponibilizando imagens que auxiliem o seu reconhecimento por extensionistas e agricultores no campo.
Visite o site para maiores informações: www.agronomicabr.com.br