Interceptação de Meloidogyne minor em batata-semente do Chile
06/08/2018

Ver ampliada

Juvenil de 2º estádio (J2) de Meloidogyne minor de espécime interceptado em tubérculos-semente de batata cv. Atlantic oriundos do Chile.


Ver ampliada

Juvenil de 4º estádio (J4) de Meloidogyne minor de espécime interceptado em tubérculos-semente de batata cv. Atlantic oriundos do Chile. 


Ver ampliada

Região anterior do J2 de Meloidogyne minor de espécime interceptado em tubérculos-semente de batata cv. Atlantic oriundos do Chile.


Ver ampliada

Região posterior do estádio J2, evidenciando a cauda de Meloidogyne minor de espécime interceptado em tubérculos-semente de batata cv. Atlantic oriundos do Chile. 


Ver ampliada

Eletroforese em gel de agarose (1,5%). M= marcador (GelPilot 1Kb Plus Ladder). Tamanho do produto esperado para Meloidogyne ≈ 500 pb


Ver ampliada

Os produtos da PCR com primers MF e MR, específicos para espécies do gênero Meloidogyne, foram purificados, sequenciados e analisados. Uma sequência de 494 nucleotídeos foi obtida a partir de um espécime de Meloidogyne de batata-semente do Chile, a qual apresentou 99% de similaridade com a sequência de Meloidogyne minor (Accession nº KX671113.1), cobrindo 98% da sequência, na consulta ao Blast (NCBI), com Query ID 73607, realizada em 03/08/2018.


Ver ampliada



Meloidogyne minor foi detectado em tubérculos de batata-semente cv. Atlantic, oriundas do Chile (protocolo 118872, amostra 14775). Juvenis de 2° e 4° estádios foram encontrados na amostra. Como não foram encontradas fêmeas, a confirmação da espécie foi por análise do DNA. Utilizou-se o produto da PCR multiplex {primers MF (GGGGATGTTTGAGGCAGATTTG) e MR (AACCGCTTCGGACTTCCACCAG) (Hu et al., 2011)} para sequenciamento. Outras espécies, que não M. incognitaM. enterolobii e M. javanica, geram um fragmento de ≈500 pb. O fragmento foi sequenciado e os resultados são informados nas imagens acima.

Meloidogyne minor é uma praga ausente não regulamentada (ANR) e foi descrita pela primeira vez em 2004, induzindo galhas em tubérculos de batata na Holanda e posteriormente em gramados de campos de golfe no Reino Unido e na Irlanda. Desde a sua descrição, M. minor tem sido registrado causando severos danos a algumas variedades de batata, com sintomas em tubérculos e raízes similares àqueles causados por outros nematoides listados como quarentenários, a exemplo de M. fallax e M. chitwoodi.

Nischwitz et al. (2013) apresentam imagens de juvenis de segundo estágio de M. fallax, M. minor e M. naasi.

Atualmente existem relatos apenas na Bélgica, Irlanda, Holanda, Reino Unido, Portugal, Chile  e Estados Unidos. 

De Weerdt et al. (2011) descreveram método de PCR em tempo real que possibilitou detectar M. minor após extração de espécimes do solo e plantas, pela presença de um amplicon de 64 pb. 

Referências bibliográficas:

De Weerdt, M.; Kox, L.; Waeyenberge, L.; Viaene, N.; Zijlstra, C. A 2011. Real-time PCR Assay to Identify Meloidogyne minor. Journal of Phytopathology 159(2): 80-84. Disponível em: https://onlinelibrary.wiley.com/doi/pdf/10.1111/j.1439-0434.2010.01717.x. Acesso em: 07 ago.2018.

EMBRAPA. Embrapa impediu a entrada de mais de 70 espécies de pragas agrícolas no país. Disponível em: http://www.agricultura.gov.br/noticias/embrapa-impediu-a-entrada-de-mais-de-70-especies-de-pragas-agricolas-no-pais. Acesso em: 07 ago.2018.

Hu, M. X.; K. Zhuo; Liao, J. L. "Multiplex PCR for the simultaneous identification and detection of Meloidogyne incognitaM. enterolobii, and M. javanica using DNA extracted directly from individual galls." Phytopathology 101.11 (2011): 1270-1277. Disponível em: https://apsjournals.apsnet.org/doi/pdf/10.1094/PHYTO-04-11-0095. Acesso em: 07 ago.2018.

Karssen, G., Bolk, R. J., Van Aelst, A. C., van den Beld, I., Kox, L. F., Korthals, G., Cook, R. (2004). Description of Meloidogyne minor n. sp.(Nematoda: Meloidogynidae), a root-knot nematode associated with yellow patch disease in golf courses. Nematology, 6(1), 59-72.

Mackesy, D., Robinson, A., and Sullivan, M. 2013. CPHST Pest Datasheet for Meloidogyne minor. USDA-APHIS-PPQ-CPHST. Disponível em: http://download.ceris.purdue.edu/file/3049. Acesso em: 06 ago.2018.

Nischwitz, C.; Skantar, A.; Handoo, Z. A.; Hult, M. N.; Schmitt, M. E.; McClure, M. A. 2013. Occurrence of Meloidogyne fallax in North America, and molecular characterization of M. fallax and M. minor from U.S. golf course greens. Plant Dis. 97:1424-1430. Disponível em: https://apsjournals.apsnet.org/doi/pdf/10.1094/PDIS-03-13-0263-RE. Acesso em: 07 ago.2018.

Prior, T.; Anderson, H.; Eyre, D. Root-knot nematode, Meloidogyne minor. May 2015. Disponível em: https://planthealthportal.defra.gov.uk/assets/factsheets/Meloidogyneminorfactsheet.pdf. Acesso em: 06 ago.2018.

Viaene, N.; Wiseborn, D. B.; Karssen, G. First Report of the Root-Knot Nematode Meloidogyne minor on Turfgrass in Belgium. Plant Disease, 91(7): 908. Disponível em: https://apsjournals.apsnet.org/doi/10.1094/PDIS-91-7-0908B. Acesso em: 07 ago.2018.

Wesemael, W. M., Taning, L. M., Viaene, N.; Moens, M. (2014). Life cycle and damage of the root-knot nematode Meloidogyne minor on potato, Solanum tuberosum. Nematology, 16(2), 185-192.

Zhao ZQ; Ho W; Griffin R; Surrey M; Taylor R; Aalders LT; Bell NL; Xu YM; Alexander BJ. First record of the root knot nematode, Meloidogyne minor in New Zealand with description, sequencing information and key to known species of Meloidogyne in New Zealand. Zootaxa. 2017 Feb 9;4231(2):zootaxa.4231.2.4. doi: 10.11646/zootaxa.4231.2.4. Disponível em: https://www.ncbi.nlm.nih.gov/pubmed/28187538. Acesso em: 06 ago.2018.

*******

How to cite: Ferreira, F. C.; Santin, R. C. M.; Rocha, M.; Zanin, J. Interceptação de Meloidogyne minor em batata-semente do Chile. Disponível em: http://www.agronomicabr.com.br/agriporticus/detalhe.aspx?id=767. Acesso em: 06 ago.2018.

Nova busca

Sobreo projeto

O AgriPorticus é um projeto do Agronômica, laboratório de diagnóstico fitossanitário, de iniciativa privada, credenciado pelo Ministério da Agricultura, Pecuária e Abastecimento.
Visite o site para maiores informações: www.agronomicabr.com.br